Gene name |
SPBC16A3.13 |
Gene ID |
28/C12 |
Gene synonyms/obsolete |
meu7 |
Gene product |
alpha-amylas; large
repeat insertion potential glycosylation sites; meiotic
expression upregulated; possibly Sp specific; GPI anchored
protein; glycoprotein; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
2325 |
ORF length (spliced) |
|
Entry clone length |
2325 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16A3.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATTGTCATTGAAGGA |
Rev primer name |
SPBC16A3.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAAAATCATTAACAAAGAT |
Amino acid length |
774 |
Molecular weight |
89.4 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAALLLSLLMI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |