| Gene name |
SPAC6G10.01 |
| Gene ID |
28/D02 |
| Gene synonyms/obsolete |
thi1; ntf1;
SPAC1486.10 |
| Gene product |
zinc finger protein;
zf-fungal Zn(2)-Cys(6) binuclear cluster domain; thiamine
repressible genes regulatory protein; transcriptional
regulator of nmt1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2328 |
| ORF length (spliced) |
|
| Entry clone length |
2328 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
887C:T / 892T:addition
/ 1911T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGAAGAAATAGGATT |
| Rev primer name |
SPAC6G10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCATTTTTTTCAAGGGTC |
| Amino acid length |
775 |
| Molecular weight |
88 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
21 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAIKFAVALGL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |