| Gene name |
SPAC27D7.02c |
| Gene ID |
28/B02 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic conserved
protein; involved in intracellular protein transport;
predicted coiled-coil protein; GRIP domain; possibly targetted
to golgi |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2253 |
| ORF length (spliced) |
|
| Entry clone length |
2253 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1347T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC27D7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGGGAAGATTAAAAGA |
| Rev primer name |
SPAC27D7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATATTTCACAGACAAAAGC |
| Amino acid length |
750 |
| Molecular weight |
87.2 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
214/216 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLLVEQLEL/LNSQIDELKL |
| Localization (YFP) |
cytosol; a few
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |