| Gene name |
SPAC22F3.10c |
| Gene ID |
28/B03 |
| Gene synonyms/obsolete |
gcs1 |
| Gene product |
glutamate--cysteine
ligase; involved in glutathione biosynthesis (1st step);
involved in response to cadmium ion; glutamate-cysteine ligase
activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2261 |
| ORF length (spliced) |
2010 |
| Entry clone length |
2261 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1020A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22F3.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTTTATTAGTACTCGG |
| Rev primer name |
SPAC22F3.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAGCATTTTCCAAGTAAC |
| Amino acid length |
669 |
| Molecular weight |
76.5 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTPITPLML |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |