Gene name |
SPAC2F3.13c |
Gene ID |
28/A12 |
Gene synonyms/obsolete |
|
Gene product |
tRNA-ribosyltransferase; no apparent Sc
ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1122 |
ORF length (spliced) |
1047 |
Entry clone length |
1122 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1118G:A |
Comments |
Separated from
SPAC2F3.12c later. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC2F3.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTTCTTCATTATC |
Rev primer name |
SPAC2F3.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCTTTCTTTACCATGCTCT |
Amino acid length |
348 |
Molecular weight |
38.4 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVGLPRLSI |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
moving dots |
Effect of LMB on protein
localization |
changed to: Golgi;
nucleus>cytosol |
Microscope used for
observation |
DeltaVision |