| Gene name |
SPAC2F3.13c |
| Gene ID |
28/A12 |
| Gene synonyms/obsolete |
|
| Gene product |
tRNA-ribosyltransferase; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1122 |
| ORF length (spliced) |
1047 |
| Entry clone length |
1122 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1118G:A |
| Comments |
Separated from
SPAC2F3.12c later. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC2F3.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTTCTTCATTATC |
| Rev primer name |
SPAC2F3.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTTTCTTTACCATGCTCT |
| Amino acid length |
348 |
| Molecular weight |
38.4 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVGLPRLSI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
moving dots |
| Effect of LMB on protein
localization |
changed to: Golgi;
nucleus>cytosol |
| Microscope used for
observation |
DeltaVision |