Gene name |
SPAC6F12.17 |
Gene ID |
28/A11 |
Gene synonyms/obsolete |
|
Gene product |
HAT repeat protein
(SMART); involved in polyadenylation; involved in 3' end
maturation |
Entry clone |
Cloned |
ORF length (unspliced) |
2245 |
ORF length (spliced) |
2202 |
Entry clone length |
2245 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6F12.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTCTGATGACAATGT |
Rev primer name |
SPAC6F12.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTAAATCTGGCACGCTTC |
Amino acid length |
733 |
Molecular weight |
83.9 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSVDLWTLYL/LDGFSYFLSI |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
DeltaVision |