Gene name |
SPAC343.10 |
Gene ID |
26/G12 |
Gene synonyms/obsolete |
met11; mthfr2 |
Gene product |
methylenetetrahydrofolate reductase; involved in
methionine metabolism |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
1926 |
ORF length (spliced) |
|
Entry clone length |
1926 |
No. of intron |
0 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC343.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGATTGTTGATTTGAT |
Rev primer name |
SPAC343.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAAGTCGATTTCTAAGACT |
Amino acid length |
641 |
Molecular weight |
72.1 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no expression clone
|
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|