Gene name |
SPCC320.10 |
Gene ID |
26/G04 |
Gene synonyms/obsolete |
srp72 |
Gene product |
TPR repeat protein;
protein signal sequence binding activity; involved in
intracellular protein transport; involved in protein-ER
targeting; involved in SRP-dependent cotranslational membrane
targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
1919 |
ORF length (spliced) |
1686 |
Entry clone length |
1919 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
1367A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC320.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAACCACGAAGAGGA |
Rev primer name |
SPCC320.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCAACACCACCTTGCATG |
Amino acid length |
561 |
Molecular weight |
63.2 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSDFSKALKI |
Localization (YFP) |
nuclear dots;
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |