| Gene name |
SPAC4F10.15c |
| Gene ID |
26/G03 |
| Gene synonyms/obsolete |
wsp1 |
| Gene product |
Wiskott-Aldrich
homolog; involved in stress response; involved in cytokinesis;
involved in actin cytoskeletal organization; involved in
control of the actin cytoskeleton; actin cortical patch
component; involved in actin cortical patch assembly; involved
in actin cortical patch distribution; promoter homolD box;
involved in endocytosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1919 |
| ORF length (spliced) |
1725 |
| Entry clone length |
1919 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1275G:A /
1585T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4F10.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCCATCTTCCTCTAT |
| Rev primer name |
SPAC4F10.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCCCACTCATCGTCGTCT |
| Amino acid length |
574 |
| Molecular weight |
59.6 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |