Gene name |
SPBC1773.01 |
Gene ID |
26/G05 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein;
striatin; involved in cell cycle progression; human ortholog
is expressed mainly in S and G phase; possibly binds
calmodulin |
Entry clone |
Cloned |
ORF length (unspliced) |
1920 |
ORF length (spliced) |
1839 |
Entry clone length |
1920 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1140C:T / 1393C:T /
1530T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1773.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATCCAACCTATCATT |
Rev primer name |
SPBC1773.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGTAAATATTTGCGGTCG |
Amino acid length |
612 |
Molecular weight |
69.4 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
bright large dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |