Gene name |
SPCC553.04 |
Gene ID |
26/D12 |
Gene synonyms/obsolete |
cyp9 |
Gene product |
cyclophilin;
peptidyl-prolyl cis-trans isomerase; no apparent Sc
ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1888 |
ORF length (spliced) |
1833 |
Entry clone length |
1888 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1311A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC553.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGGATGGTGCTTCACC |
Rev primer name |
SPCC553.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGTATAAACGATACTGATG |
Amino acid length |
610 |
Molecular weight |
69 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSTLDCFLSI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |