| Gene name |
SPCC576.15c |
| Gene ID |
26/E01 |
| Gene synonyms/obsolete |
ksg1 |
| Gene product |
serine/threonine
protein kinase; essential; involved in cell growth (required);
involved in conjugation (required); involved in sporulation
(required); phosphorylates SPCC24B10.07; involved in cell wall
organization and biogenesis (maintenance); homology to the
human phosphoinositide-dependent protein kinase PDK1; TOR
signaling pathway |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1888 |
| ORF length (spliced) |
1779 |
| Entry clone length |
1888 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC576.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGAAATACGCACAATCC |
| Rev primer name |
SPCC576.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACAGCACTTCTAGCAATG |
| Amino acid length |
592 |
| Molecular weight |
65.6 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |