Gene name |
SPCC825.02 |
Gene ID |
26/D11 |
Gene synonyms/obsolete |
|
Gene product |
similar to human alpha
glucosidase II beta subunit; putative protein kinase C
substrate; EF hand (inferred from context); putative LDL
receptor |
Entry clone |
Cloned |
ORF length (unspliced) |
1887 |
ORF length (spliced) |
1521 |
Entry clone length |
1887 |
No. of intron |
6 |
Sequence status |
Finished |
Sequence results |
1397A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC825.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTCAGTCAATGGTA |
Rev primer name |
SPCC825.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAACTCATCGACAGATGAT |
Amino acid length |
506 |
Molecular weight |
57 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTNLLDELTL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |