| Gene name |
SPBC1604.20c |
| Gene ID |
26/D10 |
| Gene synonyms/obsolete |
tea2; klp4 |
| Gene product |
kinesin-like protein;
KIP2 subfamily; involved in cell polarity (required); involved
in microtubule based movement (required); involved in the
localization of polarity factors; involved in actin
cytoskeletal organization |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1887 |
| ORF length (spliced) |
|
| Entry clone length |
1887 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1473T:C /
1688C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1604.20.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCATCTTCCTCAAA |
| Rev primer name |
SPBC1604.20.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAAAGAAGTTGCGTTTCC |
| Amino acid length |
628 |
| Molecular weight |
70 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
dots on cytoplasmic
microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle |
| Microscope used for
observation |
DeltaVision |