Gene name |
SPBC1604.20c |
Gene ID |
26/D10 |
Gene synonyms/obsolete |
tea2; klp4 |
Gene product |
kinesin-like protein;
KIP2 subfamily; involved in cell polarity (required); involved
in microtubule based movement (required); involved in the
localization of polarity factors; involved in actin
cytoskeletal organization |
Entry clone |
Cloned |
ORF length (unspliced) |
1887 |
ORF length (spliced) |
|
Entry clone length |
1887 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1473T:C /
1688C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1604.20.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCATCTTCCTCAAA |
Rev primer name |
SPBC1604.20.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAAAGAAGTTGCGTTTCC |
Amino acid length |
628 |
Molecular weight |
70 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
dots on cytoplasmic
microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle |
Microscope used for
observation |
DeltaVision |