| Gene name |
SPCC613.01 |
| Gene ID |
24/B07 |
| Gene synonyms/obsolete |
SPBC757.14;
SPCC757.14 |
| Gene product |
transporter; unknown
specificity; similar to Sp SPCC613.02 and SPCC330.07c and
SPCC757.11c (paralogs); conserved in A. thaliana; no apparent
Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1494 |
| ORF length (spliced) |
|
| Entry clone length |
1494 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Not analyzed correctly
(sequence_seqL2). |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC613.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCACTACGACCGAAAC |
| Rev primer name |
SPCC613.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAGTCTTGGTTTTAATA |
| Amino acid length |
497 |
| Molecular weight |
55.1 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |