Gene name |
SPCC613.02 |
Gene ID |
24/B08 |
Gene synonyms/obsolete |
|
Gene product |
transporter; unknown
specificity; similar to SpSPCC613.01 and SPCC330.07c and
SPCC757.11c (paralogs); conserved in A. thaliana; no apparent
Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1494 |
ORF length (spliced) |
|
Entry clone length |
1494 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC613.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCATCAGTATTGAAAC |
Rev primer name |
SPCC613.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCCAGTCTTAGTCTTGATG |
Amino acid length |
497 |
Molecular weight |
55.3 |
Isoelectric point (calc.) |
9 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYGFILGILAL/LVFIQLLFL |
Localization (YFP) |
periphery; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |