| Gene name |
SPCC613.02 |
| Gene ID |
24/B08 |
| Gene synonyms/obsolete |
|
| Gene product |
transporter; unknown
specificity; similar to SpSPCC613.01 and SPCC330.07c and
SPCC757.11c (paralogs); conserved in A. thaliana; no apparent
Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1494 |
| ORF length (spliced) |
|
| Entry clone length |
1494 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC613.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCATCAGTATTGAAAC |
| Rev primer name |
SPCC613.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCCAGTCTTAGTCTTGATG |
| Amino acid length |
497 |
| Molecular weight |
55.3 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYGFILGILAL/LVFIQLLFL |
| Localization (YFP) |
periphery; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |