| Gene name |
SPBC646.10c |
| Gene ID |
24/B06 |
| Gene synonyms/obsolete |
|
| Gene product |
ribonucleoprotein
(RNP) complex; processome component; involved in rRNA
processing; snoRNA binding domain; U3 snoRNP component; C/D
box snoRNP component; involved in 2'-O-methylation of
rRNAs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1494 |
| ORF length (spliced) |
|
| Entry clone length |
1494 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
485A:G / 1228T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC646.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATTACTTGTTGTA |
| Rev primer name |
SPBC646.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGGCTCTTCTTTTTCTTC |
| Amino acid length |
497 |
| Molecular weight |
55.3 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
474/475/459/492 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNDFLKNFLEL |
| Localization (YFP) |
nucleolus>>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus |
| Microscope used for
observation |
DeltaVision |