Gene name |
SPAC12G12.07c |
Gene ID |
22/C08 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical
coiled-coil protein; no Sc ortholog; similar to A. thaliana
T7N9.15; has domain similar to integrin-a cytoplasmic region
|
Entry clone |
Cloned |
ORF length (unspliced) |
1286 |
ORF length (spliced) |
1239 |
Entry clone length |
1286 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC12G12.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAAGCCAGGGAAACAA |
Rev primer name |
SPAC12G12.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGCTACGGGATTGAAATTG |
Amino acid length |
412 |
Molecular weight |
45.7 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
Confocal |