Gene name |
SPAC1F12.01c |
Gene ID |
19/D12 |
Gene synonyms/obsolete |
SPAC1556.08c |
Gene product |
involved in glucose
derepression; 5'-AMP-activated (gamma subunit) (#needs check);
CBS domain protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1224 |
ORF length (spliced) |
1005 |
Entry clone length |
1224 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
143T:C / 813T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1F12.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGACGTTCAAGAGAC |
Rev primer name |
SPAC1F12.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACGGCAGATTCAAAATTA |
Amino acid length |
334 |
Molecular weight |
37.4 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFVVDENLKL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |