| Gene name |
SPAC22F8.01 |
| Gene ID |
19/D11 |
| Gene synonyms/obsolete |
arp2;
SPAC11H11.06 |
| Gene product |
ARP2/3
actin-organizing complex; involved in actin assembly and
function; involved in actin cortical patch assembly;
actin-like protein; involved in cell polarity; involved in
endocytosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1223 |
| ORF length (spliced) |
1173 |
| Entry clone length |
1223 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22F8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTCTGCTCCCATTGT |
| Rev primer name |
SPAC22F8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTAGTTCTAGGACCCAAT |
| Amino acid length |
390 |
| Molecular weight |
44.2 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCYVSYDLEL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|