Gene name |
SPBC15D4.11c |
Gene ID |
13/H01 |
Gene synonyms/obsolete |
|
Gene product |
conserved hypothetical
protein; low similarity to mitochondrial glycoprotein mam33
family which bind to the globular heads of C1q; no apparent
orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
971 |
ORF length (spliced) |
792 |
Entry clone length |
971 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
686T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC15D4.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCAGAAAAGCGATCTC |
Rev primer name |
SPBC15D4.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGGGAGTCTGATTTTTTA |
Amino acid length |
263 |
Molecular weight |
30.2 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |