| Gene name |
SPBC215.15 |
| Gene ID |
13/G12 |
| Gene synonyms/obsolete |
sec13 |
| Gene product |
WD repeat protein;
COPII-coated vesicle component; DMSO-sensitive conditional
mutant is defective for septation; involved in septation
(inferred); nuclear pore complex; involved in intracellular
protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
970 |
| ORF length (spliced) |
894 |
| Entry clone length |
970 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC215.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGACCGTAGATACACA |
| Rev primer name |
SPBC215.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTGCTCAGTTCATTGAGA |
| Amino acid length |
297 |
| Molecular weight |
32.5 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |