| Gene name |
SPAC13G6.09 |
| Gene ID |
13/G11 |
| Gene synonyms/obsolete |
|
| Gene product |
similar to C. elegans
R07E5.10 and human and R. norvegicus RP-8 proteins; programmed
cell death protein 2 C-terminal domain; zinc finger protein;
zf-MYND type (inferred from context); non-essential; no
apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
970 |
| ORF length (spliced) |
825 |
| Entry clone length |
970 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
769T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13G6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGATGTTGATTTGGG |
| Rev primer name |
SPAC13G6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCAGGTGCTATAATTCCT |
| Amino acid length |
274 |
| Molecular weight |
31 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |