| Gene name |
SPAC31G5.11 |
| Gene ID |
08/D02 |
| Gene synonyms/obsolete |
pac2 |
| Gene product |
cAMP-independent
regulatory protein; controls the onset of sexual development;
similar to Sp gti1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
708 |
| ORF length (spliced) |
|
| Entry clone length |
708 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
(-2)A:deletion /
635T:C |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31G5.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACTTATACAGGTAT |
| Rev primer name |
SPAC31G5.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGCCATAGGGCTTGACGC |
| Amino acid length |
235 |
| Molecular weight |
26.1 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDKLRQALWL |
| Localization (YFP) |
SPB;
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |