Gene name |
SPAC31G5.11 |
Gene ID |
08/D02 |
Gene synonyms/obsolete |
pac2 |
Gene product |
cAMP-independent
regulatory protein; controls the onset of sexual development;
similar to Sp gti1 |
Entry clone |
Cloned |
ORF length (unspliced) |
708 |
ORF length (spliced) |
|
Entry clone length |
708 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
(-2)A:deletion /
635T:C |
Comments |
5' terminus is
frameshifted. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC31G5.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACTTATACAGGTAT |
Rev primer name |
SPAC31G5.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAGCCATAGGGCTTGACGC |
Amino acid length |
235 |
Molecular weight |
26.1 |
Isoelectric point (calc.) |
7.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDKLRQALWL |
Localization (YFP) |
SPB;
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |