Gene name |
SPAC23C11.08 |
Gene ID |
08/D01 |
Gene synonyms/obsolete |
php3 |
Gene product |
CCAAT-box binding
factor; required for growth on non-fermentable carbon
sources |
Entry clone |
Cloned |
ORF length (unspliced) |
708 |
ORF length (spliced) |
351 |
Entry clone length |
708 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23C11.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGCAGACGGGTTGGA |
Rev primer name |
SPAC23C11.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGAGGCTCTTCGGACCGG |
Amino acid length |
116 |
Molecular weight |
12.9 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|