| Gene name |
SPAC24H6.07 |
| Gene ID |
07/A04 |
| Gene synonyms/obsolete |
rps901; rps9a;
rps9-1 |
| Gene product |
40S ribosomal protein
S9; similar to Sp rps902 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
621 |
| ORF length (spliced) |
576 |
| Entry clone length |
621 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24H6.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCCGCACCTGTAAG |
| Rev primer name |
SPAC24H6.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCTTCTTCGGCTTCTTCT |
| Amino acid length |
191 |
| Molecular weight |
22.1 |
| Isoelectric point (calc.) |
11 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDYVLALRI/LQTQVFKLGL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |