| Gene name | 
                SPBP35G2.12 | 
              
                | Gene ID | 
                07/A03 | 
              
                | Gene synonyms/obsolete | 
                 | 
              
                | Gene product | 
                nucleoside 
                  diphosphate-sugar hydrolase; Nudix family hydrolase | 
              
                | Entry clone | 
                Cloned | 
              
                | ORF length (unspliced) | 
                618 | 
              
                | ORF length (spliced) | 
                 | 
              
                | Entry clone length | 
                618 | 
              
                | No. of intron | 
                0 | 
              
                | Sequence status | 
                Finished | 
              
                | Sequence results | 
                443A:G / 571A:G | 
              
                | Comments | 
                 | 
              
                | Polymerase used for cloning | 
                Platinum Taq HiFi 
                  (Invitrogen) | 
              
                | Fwd primer name | 
                SPBP35G2.12.Fd | 
              
                | Fwd primer SEQ | 
                AAAAAGCAGGCTCTCATATGAGCCAAGATCAAAAACC | 
              
                | Rev primer name | 
                SPBP35G2.12.Rv | 
              
                | Rev primer SEQ | 
                AGAAAGCTGGGTAAGACGACAAGTATTTAAGA | 
              
                | Amino acid length | 
                205 | 
              
                | Molecular weight | 
                23 | 
              
                | Isoelectric point (calc.) | 
                4.6 | 
              
                | Signal SEQ | 
                 | 
              
                | No. of transmembrane domain | 
                 | 
              
                | NLS position (Columbia Univ. 
                  Bioinformatics Center) | 
                none | 
              
                | NES motif ( 
                  L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) | 
                none | 
              
                | Localization (YFP) | 
                nucleus>cytosol 
               | 
              
                | Comments for localization | 
                 | 
              
                | Effect of LMB on protein 
                  localization | 
                no change | 
              
                | Microscope used for 
                observation | 
                Zeiss |