Gene name |
SPAC5D6.10c |
Gene ID |
03/B07 |
Gene synonyms/obsolete |
|
Gene product |
very hypothetical
protein; ORF in compositionally biased region |
Entry clone |
Cloned |
ORF length (unspliced) |
408 |
ORF length (spliced) |
|
Entry clone length |
408 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
(-5)C:deletion |
Comments |
5' terminus is
frameshifted. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC5D6.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTAGTAGAGTTGAATC |
Rev primer name |
SPAC5D6.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATATTTACATTGGCACACC |
Amino acid length |
135 |
Molecular weight |
15.8 |
Isoelectric point (calc.) |
10.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
91/90 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |