Gene name |
SPBC24C6.01c |
Gene ID |
03/B06 |
Gene synonyms/obsolete |
ubl1; ned8;
SPBC12D12.08c |
Gene product |
ubiquitin family
protein; SCF ubiquitin ligase activator; induced by stress;
involved in protein deneddylation; involved in protein
neddylation |
Entry clone |
Cloned |
ORF length (unspliced) |
406 |
ORF length (spliced) |
237 |
Entry clone length |
406 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
Primer's names are
different from the clone name used now. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC12D12.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTATCAAAGTAAAAGT |
Rev primer name |
SPBC12D12.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCAACTTCCTCCACGAAGA |
Amino acid length |
78 |
Molecular weight |
8.6 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
observed by N-terminal
tagging of GFP |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |