Gene name |
SPAC144.01 |
Gene ID |
03/A04 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan; confirmed intron |
Entry clone |
Cloned |
ORF length (unspliced) |
397 |
ORF length (spliced) |
339 |
Entry clone length |
397 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC144.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAAACTTAAGGCCCA |
Rev primer name |
SPAC144.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAGCTCAAGCATGTCTTCT |
Amino acid length |
112 |
Molecular weight |
13.6 |
Isoelectric point (calc.) |
10.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
87/28/82 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |