| Gene name |
SPBCPT2R1.08c |
| Gene ID |
52/C12 |
| Gene synonyms/obsolete |
|
| Gene product |
helicase, telomeric,
likely to be present at all telomere ends (minimally chr 1 and
2), no apparent orthologs, analogous to buddung yeast y'
element? |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
6303 |
| ORF length (spliced) |
|
| Entry clone length |
6303 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBCPT2R1.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAACTGGTGGTGTTGG |
| Rev primer name |
SPBCPT2R1.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATGATTTGCAAAACATCA |
| Amino acid length |
2100 |
| Molecular weight |
239.9 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|