| Gene name |
SPBC16E9.16c |
| Gene ID |
52/C11 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan; has protein product on MS analysis |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
2271 |
| ORF length (spliced) |
1929 |
| Entry clone length |
2077 |
| No. of intron |
2 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
ORF prediction was
wrong. |
| Polymerase used for cloning |
|
| Fwd primer name |
SPBC16E9.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAAAACCTTCTGGCAA |
| Rev primer name |
SPBC16E9.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGTTGGACATACCCAAG |
| Amino acid length |
642 |
| Molecular weight |
70.2 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|