| Gene name |
SPAC3H5.09c |
| Gene ID |
51/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical
protein |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
8058 |
| ORF length (spliced) |
|
| Entry clone length |
8058 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned/serious
mutation |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPAC3H5.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGGTCGTCCTCGCAAAACAC |
| Rev primer name |
SPAC3H5.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTCGGCGATTAGAAGCT |
| Amino acid length |
2685 |
| Molecular weight |
310.2 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LATFKYALEL/LQARVHRLLDL |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|