Gene name |
SPCC188.03 |
Gene ID |
51/E11 |
Gene synonyms/obsolete |
cnd3 |
Gene product |
condensin subunit;
non-SMC subunit; XCAP-G; essential; involved in chromosome
condensation (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
2838 |
ORF length (spliced) |
2628 |
Entry clone length |
2838 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC188.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTGCATTCAAATTAT |
Rev primer name |
SPCC188.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGATCTTCTTCTTGTTTA |
Amino acid length |
875 |
Molecular weight |
100.4 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPDSLISLHI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |