Gene name |
SPAC1B9.02c |
Gene ID |
51/E10 |
Gene synonyms/obsolete |
sck1 |
Gene product |
serine/threonine
protein kinase; high copy number suppressor of defects in the
cAMP-dependent protein kinase pathway; involved in trehalase
activation; C2 domain |
Entry clone |
Cloned |
ORF length (unspliced) |
2306 |
ORF length (spliced) |
2091 |
Entry clone length |
2306 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1B9.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAAATTTTCGGTAA |
Rev primer name |
SPAC1B9.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCTTCGAACGTCTCGCCG |
Amino acid length |
696 |
Molecular weight |
78.5 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (cytosol=nucleus) |
Microscope used for
observation |
DeltaVision |