| Gene name |
SPAC1B9.02c |
| Gene ID |
51/E10 |
| Gene synonyms/obsolete |
sck1 |
| Gene product |
serine/threonine
protein kinase; high copy number suppressor of defects in the
cAMP-dependent protein kinase pathway; involved in trehalase
activation; C2 domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2306 |
| ORF length (spliced) |
2091 |
| Entry clone length |
2306 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1B9.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAAATTTTCGGTAA |
| Rev primer name |
SPAC1B9.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTTCGAACGTCTCGCCG |
| Amino acid length |
696 |
| Molecular weight |
78.5 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (cytosol=nucleus) |
| Microscope used for
observation |
DeltaVision |