Gene name |
SPCC1739.15 |
Gene ID |
51/D06 |
Gene synonyms/obsolete |
wtf21; wtf3 |
Gene product |
wtf element; no
apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1328 |
ORF length (spliced) |
990 |
Entry clone length |
1328 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC794.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAATTACACTTC |
Rev primer name |
SPCC1739.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACTTCGCTTTCAACATCC |
Amino acid length |
329 |
Molecular weight |
36.8 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAKLAKVLLL/LFIMGNVLFL |
Localization (YFP) |
vacuole; ambiguous
structure |
Comments for localization |
too dark to
photo |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |