| Gene name |
SPCC1739.15 |
| Gene ID |
51/D06 |
| Gene synonyms/obsolete |
wtf21; wtf3 |
| Gene product |
wtf element; no
apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1328 |
| ORF length (spliced) |
990 |
| Entry clone length |
1328 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC794.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAATTACACTTC |
| Rev primer name |
SPCC1739.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTTCGCTTTCAACATCC |
| Amino acid length |
329 |
| Molecular weight |
36.8 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAKLAKVLLL/LFIMGNVLFL |
| Localization (YFP) |
vacuole; ambiguous
structure |
| Comments for localization |
too dark to
photo |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |