Gene name |
SPAPB17E12.02 |
Gene ID |
51/C05 |
Gene synonyms/obsolete |
yip12; yip1;
yip1-b |
Gene product |
structural similarity
with SMN protein; Yip1p structural similarity with SMN
protein; involved in spliceosomal snRNP biogenesis; similar to
Sp yip11 (paralog); duplicated in Sp; telomerase
associated(implicated); no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
887 |
ORF length (spliced) |
708 |
Entry clone length |
887 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAPB17E12.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCCTCGAAAAGAAAAAG |
Rev primer name |
SPAPB17E12.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTTTGAAAGAGATCTTTT |
Amino acid length |
235 |
Molecular weight |
26.9 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |