| Gene name |
SPBC1348.01 |
| Gene ID |
51/C04 |
| Gene synonyms/obsolete |
SPAC1348.01 |
| Gene product |
Sp specific families;
DUF999; telomeric duplication; possibly Sp specific; has late
log phase cDNA |
| Entry clone |
Cloned |
| ORF length (unspliced) |
868 |
| ORF length (spliced) |
810 |
| Entry clone length |
868 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1348.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAATCCAGAAAGCTT |
| Rev primer name |
SPAC1348.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCACAGGAGTAGGC |
| Amino acid length |
269 |
| Molecular weight |
30.5 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVLMLLSL/LYKLVILSL |
| Localization (YFP) |
vacuole |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |