Gene name |
SPBC18H10.18c |
Gene ID |
51/C01 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan; recent duplication; similar to Sp
SPCC1682.06 |
Entry clone |
Cloned |
ORF length (unspliced) |
774 |
ORF length (spliced) |
729 |
Entry clone length |
774 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC18H10.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAGACGAAAAGTTACC |
Rev primer name |
SPBC18H10.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCTGCTGCCCGATTCTACA |
Amino acid length |
242 |
Molecular weight |
27 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPFILTLLL/LAHIILSLLL |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
aggregates by over
expression; vacuole? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |