Gene name |
SPBC1348.07 |
Gene ID |
51/B12 |
Gene synonyms/obsolete |
SPAC1348.07 |
Gene product |
Sp specific families;
DUF999; telomeric duplication; possibly Sp specific |
Entry clone |
Cloned |
ORF length (unspliced) |
743 |
ORF length (spliced) |
693 |
Entry clone length |
743 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1348.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAGAGATACTCGTAA |
Rev primer name |
SPAC1348.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCACAGGAGTGGGC |
Amino acid length |
230 |
Molecular weight |
26.4 |
Isoelectric point (calc.) |
9.3 |
Signal SEQ |
|
No. of transmembrane domain |
3 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFILLLLGL |
Localization (YFP) |
vacuole |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |