| Gene name |
SPBC29A10.12 |
| Gene ID |
51/B10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved eukaryotic
protein; no apparent Sc ortholog |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
732 |
| ORF length (spliced) |
624 |
| Entry clone length |
732 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
Mixture |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from 79. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC29A10.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAATCCAAAAAAGAG |
| Rev primer name |
SPBC29A10.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCGCGTAAACGTGCTTCC |
| Amino acid length |
207 |
| Molecular weight |
24 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
4/22 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
too dark to
photo |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |