Gene name |
SPAC30C2.01c |
Gene ID |
50/A02 |
Gene synonyms/obsolete |
dhc1;
SPAC1093.06c |
Gene product |
dynein heavy chain,
cytosolic; involved in chromosome alignment in meiotic
prophase (required); involved in nuclear migration (sensu
Fungi) (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
12591 |
ORF length (spliced) |
|
Entry clone length |
12591 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1132G:T /
7108T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC30C2.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAAAAACGATAATTC |
Rev primer name |
SPAC30C2.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATGCACATACTAAAATAA |
Amino acid length |
4196 |
Molecular weight |
484.3 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; microtubules;
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |