Gene name |
SPBP19A11.04c |
Gene ID |
49/H10 |
Gene synonyms/obsolete |
mor2; cps12 |
Gene product |
involved in
transcriptional regulation; involved in cellular morphogenesis
(required); mutation induces Wee1-dependent G2 delay;
complexed with Orb6p (ISS); similar to D. melanogaster
Furry |
Entry clone |
Cloned |
ORF length (unspliced) |
6591 |
ORF length (spliced) |
|
Entry clone length |
6591 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
796A:G / 2332A:G /
2710C:T / 4903C:T / 6498T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP19A11.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTTGAATGAAATTGC |
Rev primer name |
SPBP19A11.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGCCAACCGCGGGATCGA |
Amino acid length |
2196 |
Molecular weight |
251.1 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLRAMRYLRL/LLPWLQNLEL/LVGVGYLRI/LGIVSPLLRL |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |