Gene name |
SPAPB1E7.07 |
Gene ID |
49/H09 |
Gene synonyms/obsolete |
|
Gene product |
glutamate synthase;
involved in glutamate biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
6336 |
ORF length (spliced) |
|
Entry clone length |
6336 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
294T:C / 1713T:C /
1875T:C / 2246T:C / 3087T:C / 3865A:G / 4785T:A /
5421T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB1E7.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGTCTTATCTTCAGT |
Rev primer name |
SPAPB1E7.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACAATTAACAGTGCGCTTT |
Amino acid length |
2111 |
Molecular weight |
232.8 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |