| Gene name |
SPAPB8E5.07c |
| Gene ID |
49/G02 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic conserved
protein; involved in rRNA processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3492 |
| ORF length (spliced) |
|
| Entry clone length |
3492 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
424A:G / 482T:C /
1470A:G / 1571G:A / 2346A:G / 2506T:C / 2744C:T / 2804T:C /
2913T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB8E5.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGAAGTGAATGAACC |
| Rev primer name |
SPAPB8E5.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATATCCTTTTTGTCCACGT |
| Amino acid length |
1163 |
| Molecular weight |
130.5 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNVLEKLLLL/LRVLPLNLEL/LVQLISTLNL |
| Localization (YFP) |
SPB?; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |