| Gene name |
SPAC688.01 |
| Gene ID |
49/F09 |
| Gene synonyms/obsolete |
SPAC589.12 |
| Gene product |
hypothetical protein;
involved in sensitivity to certain drugs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3100 |
| ORF length (spliced) |
2916 |
| Entry clone length |
3100 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
72T:C / 275A:G /
1308A:G / 2499G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC688.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGAAAAAACAAGCTC |
| Rev primer name |
SPAC688.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATAGTACCACGGCTCG |
| Amino acid length |
971 |
| Molecular weight |
110 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
19 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
665 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |