Gene name |
SPAC688.01 |
Gene ID |
49/F09 |
Gene synonyms/obsolete |
SPAC589.12 |
Gene product |
hypothetical protein;
involved in sensitivity to certain drugs |
Entry clone |
Cloned |
ORF length (unspliced) |
3100 |
ORF length (spliced) |
2916 |
Entry clone length |
3100 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
72T:C / 275A:G /
1308A:G / 2499G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC688.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGAAAAAACAAGCTC |
Rev primer name |
SPAC688.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCATAGTACCACGGCTCG |
Amino acid length |
971 |
Molecular weight |
110 |
Isoelectric point (calc.) |
7.6 |
Signal SEQ |
|
No. of transmembrane domain |
19 |
NLS position (Columbia Univ.
Bioinformatics Center) |
665 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |