| Gene name |
SPBC1105.01 |
| Gene ID |
49/F08 |
| Gene synonyms/obsolete |
SPBPB7E8.03 |
| Gene product |
involved in rRNA
processing; exosome (RNase complex); nuclear exosome (RNase
complex) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3090 |
| ORF length (spliced) |
3006 |
| Entry clone length |
3090 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
671G:A / 869A:G /
1070A:deletion / 1447G:A / 2126T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1105.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAAAGACAGACGCATG |
| Rev primer name |
SPBC1105.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCTTTTTTTGAACCCTT |
| Amino acid length |
1001 |
| Molecular weight |
112.8 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFHLDTLLPL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |