| Gene name |
SPAP32A8.01c |
| Gene ID |
49/F01 |
| Gene synonyms/obsolete |
apc5;
SPAC959.09c |
| Gene product |
anaphase-promoting
complex (APC); involved in cyclin degradation (required);
involved in metaphase-anaphase transition |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2692 |
| ORF length (spliced) |
2214 |
| Entry clone length |
2692 |
| No. of intron |
9 |
| Sequence status |
Finished |
| Sequence results |
806T:C / 2659T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP32A8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAACACCAATATTTCC |
| Rev primer name |
SPAP32A8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTAGCAAATTGTCGGAA |
| Amino acid length |
737 |
| Molecular weight |
85.3 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLRGLCTLCL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |