| Gene name |
SPBC691.03c |
| Gene ID |
49/E12 |
| Gene synonyms/obsolete |
apl3; pi033;
SPACTOKYO_453.02c |
| Gene product |
adaptin; AP-2 adaptor
complex; involved in vesicule-mediated transport; Adaptins are
components of the adaptor complexes which link clathrin to
receptors in coated vesicles. Clathrin-associated protein
complexes are believed to interact with the cytoplasmic tails
of membrane proteins, leading to their selection and
concentration; Alpha adaptin is a subunit of the plasma
membrane adaptor |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2637 |
| ORF length (spliced) |
|
| Entry clone length |
2637 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
433G:A / 666A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC691.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGGCTAGCAACAATAT |
| Rev primer name |
SPBC691.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACGAATTCCTTAAAATC |
| Amino acid length |
878 |
| Molecular weight |
100 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIGYLAVALLL/LIRVLDRILSL |
| Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots at periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |