| Gene name |
SPBC106.09 |
| Gene ID |
48/G04 |
| Gene synonyms/obsolete |
cut4; apc1 |
| Gene product |
Cut4
anaphase-promoting complex (APC); involved in cyclin
degradation (required); involved in metaphase-anaphase
transition (required); putative target for the spindle
checkpoint pathway; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4377 |
| ORF length (spliced) |
|
| Entry clone length |
4377 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC106.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAGAATTAAAAACAAA |
| Rev primer name |
SPBC106.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACAGATTCTTCATTATGA |
| Amino acid length |
1458 |
| Molecular weight |
165.4 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNDPLDELTL/LESPMSPSLPI/LSVIRYVLPL/LHFISEELRL/LVEEMVRLGI/LCIIFTVLEI/LPGMSDLKL/LAGICFSLGL/LSRDLVEDLSL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |